Prev. |  KEGG KO K13780 > 

RIKEN DNA Bank Human Resource - SLC7A5

Gene ID NCBI Gene 8140 |  KEGG hsa:8140
Gene Symbol SLC7A5
Protein Name solute carrier family 7 member 5
Synonyms 4F2LC|CD98|D16S469E|E16|LAT1|MPE16
Ortholog resource in our bank

  SLC7A5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011661 IRAK029C13 pCMV-SPORT6 BC042600 NM_003486 Full
HGX027872 IRAK069L08 pCMV-SPORT6 BC039692 NM_003486 Full/var
HGY092248 IRAL030K08 pOTB7 BC014177 NM_003486

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007426 W01A018J10 pENTR-TOPO IRAK029C13 BC042600 NM_003486 done
HGE007428 W01A018J12 pENTR-TOPO IRAK029C13 BC042600 NM_003486  
HGE007430 W01A018J14 pENTR-TOPO IRAK029C13 BC042600 NM_003486  
HGE037876 W01A094L12 pENTR-TOPO IRAK069L08 BC039692 NM_003486  
HGE037882 W01A094L18 pENTR-TOPO IRAK069L08 BC039692 NM_003486  
HGE037886 W01A094L22 pENTR-TOPO IRAK069L08 BC039692 NM_003486  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172100 ARi30E04 pGCAP10 NM_003486.5  
CGGCCGGCCGATGACGCAGCTGCGGGCGGCGGGCGGCGCGCACACTGCTCGCTGGGCCGC
HKR397634 RBd94B10 pGCAP10 NM_003486.5  
GACGCAGCTGCGGGCGGCGGGCGGCGCGCACAGTGCTCGCTGGGCCGCGGCTCCCGGGTG
HKR428258 RBdS070K18 pGCAP10 NM_003486.5  
GACGCAGCTGCGGGCGGCGGGCGGCGCGCACAGTGCTCGCTGGGCCGCGGCTCCCGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl