Prev. |  KEGG KO K12397 > 

RIKEN DNA Bank Human Resource - AP3B2

Gene ID NCBI Gene 8120 |  KEGG hsa:8120
Gene Symbol AP3B2
Protein Name adaptor related protein complex 3 subunit beta 2
Synonyms EIEE48|NAPTB
Ortholog resources KEGG ortholog (KEGG orthology K12397) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR386456 RBd66C08 pGCAP10 NM_004644.3  
CGGCCGGNCGATGGCGCCGCCGCCTTCGCCAGCCCGGACCGGACCGGCCCGCCTTCCCTT
HKR441771 RBdS104H03 pGCAP10 NM_004644.3  
GNAAATNCNCGCNNNNNNNCCGCCNCTNCACANTGCANCNNCTGCTGAACCCCTGCCGCG
HKR441896 RBdS104M08 pGCAP10 NM_004644.3  
GCCTCGCGGACACGCCCTCCGCTCGGCTGGCGCCGGTGCCTTTAAGACCTCAGCGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl