Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AP3B2

Gene ID (NCBI) 8120
Gene Symbol AP3B2
Protein Name adaptor related protein complex 3 beta 2 subunit
Synonyms EIEE48|NAPTB
Databases KEGG hsa:8120 |  NCBI Gene 8120
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12397)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR386456 RBd66C08 pGCAP10 NM_004644.3  
CGGCCGGNCGATGGCGCCGCCGCCTTCGCCAGCCCGGACCGGACCGGCCCGCCTTCCCTT
HKR441771 RBdS104H03 pGCAP10 NM_004644.3  
GNAAATNCNCGCNNNNNNNCCGCCNCTNCACANTGCANCNNCTGCTGAACCCCTGCCGCG
HKR441896 RBdS104M08 pGCAP10 NM_004644.3  
GCCTCGCGGACACGCCCTCCGCTCGGCTGGCGCCGGTGCCTTTAAGACCTCAGCGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl