Prev. | 

RIKEN DNA Bank Human Resource - CDK2AP1

Gene ID NCBI Gene 8099 |  KEGG hsa:8099
Gene Symbol CDK2AP1
Protein Name cyclin dependent kinase 2 associated protein 1
Synonyms DOC1|DORC1|ST19|doc-1|p12DOC-1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011534 IRAK028N22 pCMV-SPORT6 BC034717 NM_004642 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003921 W01A009N09 pENTR-TOPO IRAK028N22 BC034717 NM_004642  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062452 ARe56C04 pKA1U5 NM_004642.2  
TGGGATTCTAATCCTGGGGCTTGGCCAGACCTNCCTTTNNAGGAATGATCTACGTGCTTA
HKR074171 ARe85H03 pKA1U5 NM_004642.2  
GAGTTTGCGGCCGCCCCTGCGCCGCACCCGGGGCCTGGGTGAGACTGCGGCGGCGGCAGG
HKR332953 RBb32G09 pGCAP1 NM_004642.2  
HKR374475 RBd36D03 pGCAP10 NM_004642.2  
GAAATACACCACTCGCCACCATTTTCTCCAGCTGGGAGTGTCCACTCGCCTTCCACCAGC
HKR376508 RBd41E12 pGCAP10 NM_004642.2  
GGGAGAAGGCCTCTAAGCTTTTGTCAGTCTCAAAGGAGTCTTGGATCCCCAAAGGGTTAA
HKR382150 RBd55G06 pGCAP10 NM_004642.2  
GACCGCCCGGCCTCGCCGCCGCCGCCGCCGCCCTCGCGGCCNNNNNNNGCCGCGCCCGGC
HKR433218 RBdS083A18 pGCAP10 NM_004642.2  
GGAGACTGCGGCGGCNGCAGGGCGCGNACGGCCATATTTGCCGGCGCGGCCCGAGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl