Prev. |  KEGG KO K09283 > 

RIKEN DNA Bank Human Resource - HMGA2

Gene ID NCBI Gene 8091 |  KEGG hsa:8091
Gene Symbol HMGA2
Protein Name high mobility group AT-hook 2
Synonyms BABL|HMGI-C|HMGIC|LIPO|STQTL9
Ortholog resources KEGG ortholog (KEGG orthology K09283) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008870 IRAK022C22 pCMV-SPORT6 BC018139 NM_003484 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348454 RBb71C06 pGCAP1 NM_003483.4 done
GCCAGCCCGGGCAGCGCGCGCTTGGTGCAAGACTCAGGAGCTAGCAGCCCGTCCCCCTCC
HKR375658 RBd39C10 pGCAP10 NM_003483.4  
AGAAAACTTCCAGCCCGGGCAGCGCGCGCTTGGTGCAAGACTCAGGAGCTAGCAGCCCGT
HKR405795 RBdS014I03 pGCAP10 NM_003483.4  
GCAGCCCGGGCAGCGCGCGCTTGGTGCAAGACTCAGGAGCTAGCAGCCCGTCCCCCTCCG
HKR453002 RBdS132I10 pGCAP10 NM_003483.4  
GACTCCAAGTCTCTTCCCTTTCCAAGCCGCTTCCGAAGTGCTCCCGGTGCCCGCAACTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl