Prev. |  KEGG KO K15516 > 

RIKEN DNA Bank Human Resource - FXR1

Gene ID NCBI Gene 8087 |  KEGG hsa:8087
Gene Symbol FXR1
Protein Name FMR1 autosomal homolog 1
Synonyms FXR1P
Ortholog resource in our bank

  FXR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017129 IRAK042N17 pCMV-SPORT6 BC028983 NM_001013438 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015756 W01A039G12 pENTR-TOPO IRAK042N17 BC028983 NM_001013438  
HGE015760 W01A039G16 pENTR-TOPO IRAK042N17 BC028983 NM_001013438  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069249 ARe73C01 pKA1U5 NM_005087.2  
GCTTTGCGGTTCCAACATGGCGGAGCTGACGGCNGAGGTTCGCGGCTCTAACGGGGCTTT
HKR279496 ARiS198M08 pGCAP10 NM_005087.2  
GGCGGTTCCAACATGGCGGAGCTGACGGTGGAGGTTCGCGGCTCTAACGGGGCTTTCTAC
HKR385635 RBd64B11 pGCAP10 NM_005087.2  
GCTTTTTGCGGTTCCAACATGGCGGAGCTGACGGTGGAGGTTCGCGGCTCTAACGGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl