Prev. |  KEGG KO K18041 > 

RIKEN DNA Bank Human Resource - PTP4A2

Gene ID NCBI Gene 8073 |  KEGG hsa:8073
Gene Symbol PTP4A2
Protein Name protein tyrosine phosphatase type IVA, member 2
Synonyms HH13|HH7-2|HU-PP-1|OV-1|PRL-2|PRL2|PTP4A|PTPCAAX2|ptp-IV1a|ptp-IV1b
Ortholog resources KEGG ortholog (KEGG orthology K18041) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092847 IRAL032B23 pDNR-LIB BC018662 NM_080391 Full
HGY102920 IRAL057E24 pDNR-LIB BC070182 NM_080391 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR175211 ARi38A11 pGCAP10 NM_080391.2  
GGGTGGTGGCGGCGCGATCGGCCGGGCTGTAACCGTCGTCTGTCCGGGAGCGGCTGGAGC
HKR235462 ARiS088K22 pGCAP10 NM_080391.2  
GGTCGTCTGTCCGGGAGCGGCTGGAGCGGCAGCGGCGGCCGGGCACGGCGCGAGGTGACG
HKR335775 RBb39H07 pGCAP1 NM_080391.2  
GGCGCGCGCAGCGGTGGTGGTGGCGGCGCGATCGGCCGGGCTGTAACCGTTCGTCTGTCC
HKR366428 RBd16B04 pGCAP10 NM_080391.2  
GGTCGTCTGTCCGGGAGCGGCTGGAGCGGCAGCGGCGGCCGGGCACGGCGCGAGGTGACG
HKR383373 RBd58H05 pGCAP10 NM_080391.2  
GNNCTGCGCGCGCAGCGGTGGTGGTGGCGGCGCGATCGGNNNNNNNNNNNACCGTCGTCT
HKR420673 RBdS051L09 pGCAP10 NM_080391.2  
GGTCGTCTGTCCGGGAGCGGCTGGAGCGGCAGCGGCGGCCGGGCACGGCGCGAGGTGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl