RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ADAM12

Gene ID	NCBI Gene 8038 \| KEGG hsa:8038
Gene Symbol	ADAM12
Protein Name	ADAM metallopeptidase domain 12
Synonyms	ADAM12-OT1\|CAR10\|MCMP\|MCMPMltna\|MLTN\|MLTNA

Ortholog resource in our bank

  ADAM12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR082131	ARf05F11	pKA1U5	NM_003474.4
HKR082131	ATCCTGGGCTGCACTGAAGGCCGGCGACGATGGCAGCGCGCCCGCTGCCCGTGTCCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl