Prev. |  KEGG KO K06835 > 

RIKEN DNA Bank Human Resource - ADAM12

Gene ID NCBI Gene 8038 |  KEGG hsa:8038
Gene Symbol ADAM12
Protein Name ADAM metallopeptidase domain 12
Synonyms ADAM12-OT1|CAR10|MCMP|MCMPMltna|MLTN|MLTNA
Ortholog resource in our bank

  ADAM12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082131 ARf05F11 pKA1U5 NM_003474.4  
ATCCTGGGCTGCACTGAAGGCCGGCGACGATGGCAGCGCGCCCGCTGCCCGTGTCCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl