Prev. |  KEGG KO K14616 > 

RIKEN DNA Bank Human Resource - CUBN

Gene ID NCBI Gene 8029 |  KEGG hsa:8029
Gene Symbol CUBN
Protein Name cubilin
Synonyms IFCR|MGA1|gp280
Ortholog resources KEGG ortholog (KEGG orthology K14616) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076035 ARe90B11 pKA1U5 NM_001081.3 done
GAAGCGCATGCCCTGACATTGTGCTCTTGTGTAACCAACAGTTGTCACTGCCCACCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl