Prev. |  KEGG KO K12669 > 

RIKEN DNA Bank Human Resource - TUSC3

Gene ID NCBI Gene 7991 |  KEGG hsa:7991
Gene Symbol TUSC3
Protein Name tumor suppressor candidate 3
Synonyms D8S1992|M33|MRT22|MRT7|MagT2|N33|OST3A|SLC58A2
Ortholog resource in our bank

  TUSC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087963 IRAL019P03 pDNR-LIB BC010370 NM_178234 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041073 W01A102L09 pENTR-TOPO IRAL019P03 BC010370 NM_178234  
HGE041075 W01A102L11 pENTR-TOPO IRAL019P03 BC010370 NM_178234  
HGE041079 W01A102L15 pENTR-TOPO IRAL019P03 BC010370 NM_178234  
HGE041083 W01A102L19 pENTR-TOPO IRAL019P03 BC010370 NM_178234  
HGE041085 W01A102L21 pENTR-TOPO IRAL019P03 BC010370 NM_178234  
HGE041087 W01A102L23 pENTR-TOPO IRAL019P03 BC010370 NM_178234  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066570 ARe66H02 pKA1U5 NM_006765.2  
GGCTCTGTCAGTCTCCTCCTCTGCGTCCTCGGCCGCGGCCCGGGTCCCTCGCAAAGCCGC
HKR077612 ARe94A12 pKA1U5 NM_006765.2  
GAGTCTCCTCCTCTGCGTCCTCGGCCGCGGCCCGGGTCCCTCGCAAAGCCGCTGCCATCC
HKR162831 ARi07B07 pGCAP10 NM_006765.2  
GAGTCTCCTCCTCTGCGTCCTCGGCCGCGGCCCGGGTCCCTCGCAAAGCCGCTGCCATCC
HKR222090 ARiS055D18 pGCAP10 NM_006765.2  
GCTCTGCGTCCTCGGCCGCGGCCCGGGTCCCTCGCAAAGCCGCTGCCATCCCGGAGGGCC
HKR432759 RBdS081O23 pGCAP10 NM_006765.2  
GAGTCTCCTCCTCTGCGTCCTCGGCCGCGGCCCGGGTCCCTCGCAAAGCCGCTGCCATCC
HKR441763 RBdS104G19 pGCAP10 NM_006765.2  
GAGTCTCCTCCTCTGCGTCCTCGGCCGCGGCCCGGGTCCCTCGCAAAGCCGCTGCCATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl