Prev. |  KEGG KO K02329 > 

RIKEN DNA Bank Human Resource - FZD3

Gene ID NCBI Gene 7976 |  KEGG hsa:7976
Gene Symbol FZD3
Protein Name frizzled class receptor 3
Synonyms Fz-3
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Axon guidance - human
Ortholog resource in our bank

  FZD3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161746 ARi04G02 pGCAP10 NM_017412.2  
GGCGCGCCGGCGTTCCTCGGCCGCTCCGGGTACCTGAGGGACGCGCGGCCGCCCGCGGCA
HKR408887 RBdS022D15 pGCAP10 NM_017412.2  
GGTTCCTCGGCCGCTCCGGGTACCTGAGGGACGCGCGGCCGCCCGCGGCAGGCGGTGCAG
HKR470863 RBdS177C15 pGCAP10 NM_017412.2  
GGGCGTTCCTCGGCCGCTCCGGGTACCTGAGGGACGCGCGGCCGCCCGCGGCAGGCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl