Prev. |  KEGG KO K15438 > 

RIKEN DNA Bank Human Resource - AIMP2

Gene ID NCBI Gene 7965 |  KEGG hsa:7965
Gene Symbol AIMP2
Protein Name aminoacyl tRNA synthetase complex interacting multifunctional protein 2
Synonyms JTV-1|JTV1|P38
Ortholog resources KEGG ortholog (KEGG orthology K15438) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007701 IRAK019E05 pCMV-SPORT6 BC013630 NM_006303 Full/var
HGY085164 IRAL012P04 pOTB7 BC002853 NM_006303 Full
HGY090929 IRAL027F09 pOTB7 BC010156 NM_006303 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR329773 RBb24H05 pGCAP1 NM_006303.3  
GTTCCCGAACGCCCGCAGCAGGGTCAGAAGGGAGGTGGCCGGTCTCCGTCGTGACCTCTG
HKR343752 RBb59G08 pGCAP1 NM_006303.3  
TTTGGCACAAGGGAGATGTCCGCCCCCAGTCGTAGCCTCGGACGGTTTCTGAGCGTTGGT
HKR362851 RBd07C03 pGCAP10 NM_006303.3  
GAAGGGAGGTGGCCGGTCTCCGTCGTGACCTCTGACGGTTTCTGAGCGTTGGCCTTTGGC
HKR372579 RBd31H11 pGCAP10 NM_006303.3  
GGGGAGGTGGCCGGTCTCCGTCGTGACCTCTGACGGTTTCTGAGCGTTGGCCTTTGGCAC
HKR390031 RBd75B07 pGCAP10 NM_006303.3  
TTGGACGGATTCTGAGCGTTGGCCTTTGACCCGCGCTACCCCCTTTTGCTTTGGTTCTGC
HKR392012 RBd80A12 pGCAP10 NM_006303.3  
GGTCGTGACCTCTGACGGTTTCTGAGCGTTGGCCTTTGGCACGCGCTACCCCCTTTTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl