DNA Bank Top |  KEGG KO K15590 > 

RIKEN DNA Bank Human Resource - TFEB

Gene ID NCBI Gene 7942 |  KEGG hsa:7942
Gene Symbol TFEB
Protein Name transcription factor EB
Synonyms ALPHATFEB|BHLHE35|TCFEB
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  TFEB

External database

human TFEB

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB18607 pMRX-IP TFEB-sfGFP Retroviral expression vector of human TFEB tagged with superfolder GFP.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086215 IRAL015I23 pOTB7 BC006225 NM_007162 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR433531 RBdS083N19 pGCAP10 NM_007162.1  
GAACTTCCAACAAGGGAAGGTGACATGAAAGGAGCTCAGACAATTTCTGTCCAGCAACAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl