Prev. |  KEGG KO K13370 > 

RIKEN DNA Bank Human Resource - HSD17B8

Gene ID NCBI Gene 7923 |  KEGG hsa:7923
Gene Symbol HSD17B8
Protein Name hydroxysteroid 17-beta dehydrogenase 8
Synonyms D6S2245E|FABG|FABGL|H2-KE6|HKE6|KE6|RING2|SDR30C1|dJ1033B10.9
Ortholog resources KEGG ortholog (KEGG orthology K13370) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005132 IRAK012N20 pCMV-SPORT6 BC008185 NM_014234 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091636 M01C029B12 pDONR221 MGC04-D06 BC008185 NM_014234  
HGE091684 M01C029D12 pDONR221 MGC04-D06 BC008185 NM_014234  
HGE091732 M01C029F12 pDONR221 MGC04-D06 BC008185 NM_014234  
HGE091780 M01C029H12 pDONR221 MGC04-D06 BC008185 NM_014234  
HGE091828 M01C029J12 pDONR221 MGC04-D06 BC008185 NM_014234  
HGE091876 M01C029L12 pDONR221 MGC04-D06 BC008185 NM_014234  
HGE091924 M01C029N12 pDONR221 MGC04-D06 BC008185 NM_014234  
HGE091972 M01C029P12 pDONR221 MGC04-D06 BC008185 NM_014234  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR330051 RBb25C03 pGCAP1 NM_014234.3  
GACCCACAGCCCGCCATGGCGTCTCAGCTCCAGAACCGACTCCGCTTCCGCACTGGCCTT
HKR388951 RBd72G07 pGCAP10 NM_014234.3  
GACCGACTCCGCTCCGCACTGGCCTTGGTCACAGGTGCGGGGAGCGGCATCGGCCGAGCG
HKR392529 RBd81F09 pGCAP10 NM_014234.3  
GAGCCCGCCATGGCGTCTCAGCTCCAGAACCGACTCCGCTCCGCACTGGCCTTGGTCACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl