Prev. | 

RIKEN DNA Bank Human Resource - GPANK1

Gene ID NCBI Gene 7918 |  KEGG hsa:7918
Gene Symbol GPANK1
Protein Name G-patch domain and ankyrin repeats 1
Synonyms ANKRD59|BAT4|D6S54E|G5|GPATCH10
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084908 IRAL012E12 pOTB7 BC008783 NM_033177 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235134 ARiS087N22 pGCAP10 NM_033177.2  
GGCCNTTTTGCGGTACNGAANCTACACAGCAACACGTATAGGAGACTCTCCCCGAGATCT
HKR322125 RBb05F05 pKA1U5 NM_033177.2  
GAGGGCGGGGAAAGGAGGGAGCCAGGCTGGATCTCTTTCCGCAGCTCTCCTCACGTTCCC
HKR331328 RBb28F08 pGCAP1 NM_033177.2  
TGGCCATTTTGCGGTACGGAAGCTACACAGCAACACGCTATAGGAGACTCTCCCCGAGAT
HKR390812 RBd77A12 pGCAP10 NM_033177.2  
GGCCATTTTGCGGTACGGAAGCTACACAGCAACACGTATAGGAGACTCTCCCCGAGATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl