Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PRRC2A

Gene ID (NCBI) 7916
Gene Symbol PRRC2A
Protein Name proline rich coiled-coil 2A
Synonyms BAT2|D6S51|D6S51E|G2
Databases KEGG hsa:7916 |  NCBI Gene 7916


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX043172 IRAK107P12 pCMV-SPORT6 BC060668 NM_080686 This clone has been withdrawn
HGY082235 IRAL005J19 pOTB7 BC030127 NM_080686 Partial/var
HGY095733 IRAL039F13 pOTB7 BC032134 NM_080686 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE080832 M01C002B08 pDONR221 04-134-2_1-H04 BC060668 NM_080686  
HGE080880 M01C002D08 pDONR221 04-134-2_1-H04 BC060668 NM_080686  
HGE080928 M01C002F08 pDONR221 04-134-2_1-H04 BC060668 NM_080686  
HGE080976 M01C002H08 pDONR221 04-134-2_1-H04 BC060668 NM_080686  
HGE081024 M01C002J08 pDONR221 04-134-2_1-H04 BC060668 NM_080686  
HGE081072 M01C002L08 pDONR221 04-134-2_1-H04 BC060668 NM_080686  
HGE081120 M01C002N08 pDONR221 04-134-2_1-H04 BC060668 NM_080686  
HGE081168 M01C002P08 pDONR221 04-134-2_1-H04 BC060668 NM_080686  
HGE095220 M01C038A20 pDONR221 MGC08-F10 BC060668 NM_080686  
HGE095268 M01C038C20 pDONR221 MGC08-F10 BC060668 NM_080686  
HGE095316 M01C038E20 pDONR221 MGC08-F10 BC060668 NM_080686  
HGE095364 M01C038G20 pDONR221 MGC08-F10 BC060668 NM_080686  
HGE095412 M01C038I20 pDONR221 MGC08-F10 BC060668 NM_080686  
HGE095460 M01C038K20 pDONR221 MGC08-F10 BC060668 NM_080686  
HGE095508 M01C038M20 pDONR221 MGC08-F10 BC060668 NM_080686  
HGE095556 M01C038O20 pDONR221 MGC08-F10 BC060668 NM_080686  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046921 ARe17F01 pKA1U5 NM_080686.2  
GAGTCGGGGCTCAGCCGCGGAGTGAGCGAGGGAGACGGGAGGAGCCGAACCCGGCGCCAT
HKR249181 ARiS122P21 pGCAP10 NM_080686.2  
AGTTAGTCGGGGCTCAGCCGCGGAGTGAGCGAGGGAGACGGGAGGAGCCGAACCCGGCGC
HKR382851 RBd57C03 pGCAP10 NM_080686.2  
GGGGAGGAGCCGAACCCGGCGCCATCCGCCGCCATCCTCCCCCGCCCCACCGCCATCCCG
HKR386555 RBd66G11 pGCAP10 NM_080686.2  
GAACCCCGGCGCCATCCGCCGCCATCCTCCCCCGCCCCACCGCCATCCCGTCCCGGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.04.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl