Prev. |  KEGG KO K18710 > 

RIKEN DNA Bank Human Resource - SLBP

Gene ID NCBI Gene 7884 |  KEGG hsa:7884
Gene Symbol SLBP
Protein Name stem-loop binding protein
Synonyms HBP
Ortholog resource in our bank

  SLBP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006059 IRAK015C11 pCMV-SPORT6 BC015703 NM_006527 Full
HGX006083 IRAK015D11 pCMV-SPORT6 BC014908 NM_006527 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040586 W01A101H18 pENTR-TOPO IRAK015D11 BC014908 NM_006527  
HGE040588 W01A101H20 pENTR-TOPO IRAK015D11 BC014908 NM_006527  
HGE040618 W01A101J02 pENTR-TOPO IRAK015D11 BC014908 NM_006527  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR065780 ARe64H12 pKA1U5 NM_006527.2  
GGAGCTCGTGAGCGCCGGCGCGGGGACGCGGGCTTTCTGCCTCAGGCCCTGCCCTGCTCT
HKR167630 ARi19B06 pGCAP10 NM_006527.2  
GACTCTGCGCTCTCTGCCCGCGCCGCCGCCGCCTCAGCCTCGGCCCTGCGCTGCGCGCCC
HKR243906 ARiS109M18 pGCAP10 NM_006527.2  
GCTCTGCGCTCTCTGCCCGCGCCGCCGCCGCCTCAGCCTCGGCCCTGCGCTGCGCGCCCG
HKR276466 ARiS191C18 pGCAP10 NM_006527.2  
GAGAGCTCGTGAGCGCCGGCGCGGGGACGCGGGTTTCTGCCTCAGGCCCTGCCCTGCTCT
HKR327347 RBb18G03 pKA1U5 NM_006527.2  
HKR394905 RBd87E09 pGCAP10 NM_006527.2  
GAGAGCTCGTGAGCGCCGGCGCGGGGACGCGGGTTTCTGCCTCAGGCCCTGCCCTGCTCT
HKR405877 RBdS014L13 pGCAP10 NM_006527.2  
GGAGCTCGTGAGCGCCGGCGCGGGGACGCGGGTTTCTGCCTCAGGCCCTGCCCTGCTCTA
HKR416287 RBdS040L23 pGCAP10 NM_006527.2  
GTCTGCCTCAGGCCCTGCCCTGCTCTACTCTGCGCTCTCTGCCCGCGCCGCCGCCGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl