Prev. |  KEGG KO K06840 > 

RIKEN DNA Bank Human Resource - SEMA3B

Gene ID NCBI Gene 7869 |  KEGG hsa:7869
Gene Symbol SEMA3B
Protein Name semaphorin 3B
Synonyms LUCA-1|SEMA5|SEMAA|SemA|semaV
Featured content Axon guidance - human
Ortholog resource in our bank

  SEMA3B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007680 IRAK019D08 pCMV-SPORT6 BC009113 NM_004636 Partial/var
HGY042426 IRAK106B02 pBluescript BC044602 NM_004636 Partial/var
HGY081510 IRAL003M22 pOTB7 BC024220 NM_004636 Full/var
HGY086940 IRAL017F20 pOTB7 BC013975 NM_004636 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010209 W01A025I17 pENTR-TOPO flj0011i18 AK092182 NM_004636  
HGE010213 W01A025I21 pENTR-TOPO flj0011i18 AK092182 NM_004636  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178953 ARi47G09 pGCAP10 NM_001005914.1  
GGGGCAGAGTCCAGGGCAGCTCAAGGCTCCTCCACACACACACCCGCTGAACCCTGAGCA
HKR219710 ARiS049E14 pGCAP10 NM_001005914.1  
AGCTCAAGGCTCCTCCACACACACACCCGCTGAACCCTGAGCACCCTGAGCTGCTGAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl