Prev. |  KEGG KO K04444 > 

RIKEN DNA Bank Human Resource - MAPKAPK3

Gene ID NCBI Gene 7867 |  KEGG hsa:7867
Gene Symbol MAPKAPK3
Protein Name MAPK activated protein kinase 3
Synonyms 3PK|MAPKAP-K3|MAPKAP3|MAPKAPK-3|MDPT3|MK-3|MK3
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  MAPKAPK3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081291 IRAL003D19 pOTB7 BC001662 NM_004635 Full
HGY089082 IRAL022L18 pOTB7 BC007591 NM_004635 Full
HGY089826 IRAL024J10 pOTB7 BC010407 NM_004635 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006545 W01A016G01 pENTR-TOPO IRAL003D19 BC001662 NM_004635  
HGE006547 W01A016G03 pENTR-TOPO IRAL003D19 BC001662 NM_004635  
HGE006549 W01A016G05 pENTR-TOPO IRAL003D19 BC001662 NM_004635  
HGE006551 W01A016G07 pENTR-TOPO IRAL003D19 BC001662 NM_004635  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071650 ARe79C02 pKA1U5 NM_004635.3  
TGAGCTCCCGCGACCGCCTCTCCTGCCCCTCGCCGGTTACCTCAGCAAGGTGCGTTGCCG
HKR331255 RBb28C07 pGCAP1 NM_004635.3  
GGAGGTCACGTTGGGCGCCGGCAGCGCGACTCTCGGCCCTGGGATTTCTGCGGCCGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl