Prev. |  KEGG KO K07374 > 

RIKEN DNA Bank Human Resource - TUBA1A

Gene ID NCBI Gene 7846 |  KEGG hsa:7846
Gene Symbol TUBA1A
Protein Name tubulin alpha 1a
Synonyms B-ALPHA-1|LIS3|TUBA3
Featured content Apoptosis - human
Ortholog resource in our bank

  TUBA1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14140 pCMV-TUBA1A flag-WT Expression vector of FLAG-tagged human TUBA1A (wild type).
RDB14141 pCMV-TUBA1A flag-R64W Expression vector of FLAG-tagged human TUBA1A mutant, R64W.
RDB14142 pCMV-TUBA1A flag-C25F Expression vector of FLAG-tagged human TUBA1A mutant, C25F.
RDB14143 pCMV-TUBA1A flag-R402C Expression vector of FLAG-tagged human TUBA1A mutant, R402C.
RDB14144 pCMV-TUBA1A myc-WT Expression vector of Myc-tagged human TUBA1A (wild type).
RDB14145 pCMV-TUBA1A myc-R64W Expression vector of Myc-tagged human TUBA1A mutant, R64W.
RDB14146 pCMV-TUBA1A myc-C25F Expression vector of Myc-tagged human TUBA1A mutant, C64F.
RDB14147 pCMV-TUBA1A myc-R402C Expression vector of Myc-tagged human TUBA1A mutant, R402C.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044198 IRAK110I06 pCMV-SPORT6 BC050637 NM_006009 Full
HGY083539 IRAL008O03 pOTB7 BC006468 NM_006009 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044121 ARe10F01 pKA1U5 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCCCGTTTGATAAGAAGCAACAACCTCTC
HKR051330 ARe28F10 pKA1U5 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR053210 ARe33A10 pKA1U5 NM_006009.2  
GCGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCC
HKR055679 ARe39D07 pKA1U5 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR057332 ARe43F12 pKA1U5 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR059706 ARe49E10 pKA1U5 NM_006009.2  
ATCCTGAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCT
HKR060434 ARe51B10 pKA1U5 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR063321 ARe58F01 pKA1U5 NM_006009.2  
TGGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCC
HKR067681 ARe69D09 pKA1U5 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR070077 ARe75D05 pKA1U5 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCCCGTTTGATAAGAAGCAACAACCTCTC
HKR080532 ARf01F12 pKA1U5 NM_006009.2  
TAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCT
HKR186576 ARi66H08 pGCAP10 NM_006009.2  
AGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCTT
HKR234061 ARiS085C13 pGCAP10 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR247229 ARiS118B05 pGCAP10 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR247235 ARiS118B11 pGCAP10 NM_006009.2  
GAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCT
HKR329606 RBb24A06 pGCAP1 NM_006009.2  
AGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCTT
HKR330411 RBb26A11 pGCAP1 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR332551 RBb31G07 pGCAP1 NM_006009.2  
TGGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGCTAAGAAGCAACAACCTCTC
HKR334830 RBb37B06 pGCAP1 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR345300 RBb63E04 pGCAP1 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR346922 RBb67F02 pGCAP1 NM_006009.2  
TTTGGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCTTCGTCTCCGCCATCAG
HKR347725 RBb69F05 pGCAP1 NM_006009.2  
AGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCTT
HKR461704 RBdS154E08 pGCAP10 NM_006009.2  
GAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCT
HKR462751 RBdS156O15 pGCAP10 NM_006009.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl