Prev. |  KEGG KO K19511 > 

RIKEN DNA Bank Human Resource - PXDN

Gene ID NCBI Gene 7837 |  KEGG hsa:7837
Gene Symbol PXDN
Protein Name peroxidasin
Synonyms ASGD7|COPOA|D2S448|D2S448E|MG50|PRG2|PXN|VPO
Ortholog resource in our bank

  PXDN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067288 IRAK168D16 pBluescriptR BC070119 XM_943000 Full
HGY090202 IRAL025I10 pOTB7 BC009496 XM_943000 Partial/var
HGY097661 IRAL044C13 pOTB7 BC041027 XM_943000 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380907 RBd52E11 pGCAP10 NM_012293.1  
GACAGCTGGGACGTGGGCCGCGGCCGGGCGGGCGCAGTCGGGAGCCGGCCGTGGTGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl