Prev. |  KEGG KO K20242 > 

RIKEN DNA Bank Human Resource - EVI5

Gene ID NCBI Gene 7813 |  KEGG hsa:7813
Gene Symbol EVI5
Protein Name ecotropic viral integration site 5
Synonyms EVI-5|NB4S
Ortholog resource in our bank

  EVI5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15021 pEGFP-C1-human EVI5 Expression vector of human ecotropic viral integration site 5 (EVI5), fused with N-terminal EGFP, CMV promoter.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR397299 RBd93E03 pGCAP10 NM_005665.4 VA done
GACCCCGGAGGAACCAGCTGGCCAGCTGGCAAGGGGCTGGCTGCAGTTCCGACAGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl