Prev. |  KEGG KO K06273 > 

RIKEN DNA Bank Human Resource - ZYX

Gene ID NCBI Gene 7791 |  KEGG hsa:7791
Gene Symbol ZYX
Protein Name zyxin
Synonyms ESP-2|HED-2
Ortholog resource in our bank

  ZYX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082100 IRAL005E04 pOTB7 BC008743 NM_003461 Full
HGY082170 IRAL005H02 pOTB7 BC017183 NM_003461 Partial/var
HGY082855 IRAL007C07 pOTB7 BC002323 NM_003461 Full/var
HGY090748 IRAL026O12 pOTB7 BC009360 NM_003461 Full
HGY090865 IRAL027C17 pOTB7 BC010031 NM_003461 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100043 M01C050B19 pDONR221 MGC14-G10 BC008743 NM_003461  
HGE100091 M01C050D19 pDONR221 MGC14-G10 BC008743 NM_003461  
HGE100139 M01C050F19 pDONR221 MGC14-G10 BC008743 NM_003461  
HGE100187 M01C050H19 pDONR221 MGC14-G10 BC008743 NM_003461  
HGE100235 M01C050J19 pDONR221 MGC14-G10 BC008743 NM_003461  
HGE100283 M01C050L19 pDONR221 MGC14-G10 BC008743 NM_003461  
HGE100331 M01C050N19 pDONR221 MGC14-G10 BC008743 NM_003461  
HGE100379 M01C050P19 pDONR221 MGC14-G10 BC008743 NM_003461  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042953 ARe07G09 pKA1U5 NM_003461.4  
GCTCCCCGCCCGGCTGGAGGCTGCTCCGGACCGGGACGCAGAGTCTGCGGACCCGGCGCC
HKR047249 ARe18C01 pKA1U5 NM_003461.4  
GCCCGCCCGGCTGGAGGCTGCTCCGGACCGGGACGCAGAGTCTGCGGACCCGGCGCCGAG
HKR050807 ARe27A07 pKA1U5 NM_003461.4  
GGCCCGGCTGGAGGCTGCTCCGGACCGGGACGCAGAGTCTGCGGACCCGGCGCCGAGGCG
HKR061748 ARe54G04 pKA1U5 NM_003461.4  
GGCTCCGGACCGGGACGCAGAGTCTGCGGACCCGGCGCCGAGGCGGCCACCCGAGACGCG
HKR161652 ARi04C04 pGCAP10 NM_003461.4  
GGCAGAGTCTGCGGACCCGGCGCCGAGGCGGCCACCCGAGACGCGGCGCGCACGCTCCGG
HKR162053 ARi05C05 pGCAP10 NM_003461.4  
GGGGGCGGCGGGGGCGGCAGTGAGTGGGGTGGTGTCTANCCNACCCCAGCAGAACCACCG
HKR180906 ARi52E10 pGCAP10 NM_003461.4  
TTGGGACCGGGACGCAGAGTCTGCGGACCCGGCGCCGAGGCGGCCACCCGAGACGCGGCG
HKR218053 ARiS045C05 pGCAP10 NM_003461.4  
GGCTCCGGACCGGGACGCAGAGTCTGCGGACCCGGCGCCGAGGCGGCCACCCGAGACGCG
HKR442146 RBdS105G02 pGCAP10 NM_003461.4  
GGGCTGGAGGCTGCTCCGGACCGGGACGCAGAGTCTGCGGACCCGGCGCCGAGGCGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl