Prev. |  KEGG KO K14688 > 

RIKEN DNA Bank Human Resource - SLC30A1

Gene ID NCBI Gene 7779 |  KEGG hsa:7779
Gene Symbol SLC30A1
Protein Name solute carrier family 30 member 1
Synonyms ZNT1|ZRC1
Ortholog resource in our bank

  SLC30A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR122152 ARh05G08 pGCAP1 NM_021194.2  
GAAGAAGGCGCCCGAGACCGGGCCGAGTGCAGCTGCCGTGGCCGCCGCCTCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl