Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF112

Gene ID NCBI Gene 7771 |  KEGG hsa:7771
Gene Symbol ZNF112
Protein Name zinc finger protein 112
Synonyms ZFP112|ZNF228
Ortholog resource in our bank

  ZNF112

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE032936 W01A082F16 pENTR-TOPO flj0034l20 AK023099 NM_013380  
HGE032938 W01A082F18 pENTR-TOPO flj0034l20 AK023099 NM_013380  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054154 ARe35G10 pKA1U5 NM_013380.3  
GAGAGCCACTTCCGCCCCAGGATACGCTAGGCCGCGGNCTTCGTTCCTCCCAGAAAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl