Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF226

Gene ID NCBI Gene 7769 |  KEGG hsa:7769
Gene Symbol ZNF226
Protein Name zinc finger protein 226
Synonyms -
Ortholog resource in our bank

  ZNF226

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084483 IRAL011D11 pOTB7 BC024197 NM_015919 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017954 W01A044O18 pENTR-TOPO IRAL011D11 BC024197 NM_015919  
HGE017956 W01A044O20 pENTR-TOPO IRAL011D11 BC024197 NM_015919  
HGE017958 W01A044O22 pENTR-TOPO IRAL011D11 BC024197 NM_015919  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050549 ARe26G05 pKA1U5 NM_015919.3  
GGACGTAGCAGCCATCTTTTCCCTGGCTTTGGTGATTCAGAAACTCCCGTTCTGTGGCGA
HKR420430 RBdS051B06 pGCAP10 NM_015919.3  
GGGCACTTCCGCCCAGGAAGACGACGTAGCAGCCATCTTTTCCCTGGCTTTGGTGATTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl