Prev. | 

RIKEN DNA Bank Human Resource - ZFAND5

Gene ID NCBI Gene 7763 |  KEGG hsa:7763
Gene Symbol ZFAND5
Protein Name zinc finger AN1-type containing 5
Synonyms ZA20D2|ZFAND5A|ZNF216
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069798 IRAK174I06 pCMV-SPORT6 BC073131 NM_006007 Full
HGY086263 IRAL015K23 pOTB7 BC027707 NM_006007 Full
HGY087979 IRAL019P19 pDNR-LIB BC011018 NM_006007 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR382831 RBd57B07 pGCAP10 NM_006007.2  
GGTTAGTCGGCCGGGACGCGGAGCTGTGTGCATCTCCTACGCGGNCNCGCTCGCTCCCGG
HKR416076 RBdS040D04 pGCAP10 NM_006007.2  
GAGTCGGCCGGGACGCGGAGCTGTGTGCATCTCCTACGCGGGCTCGCTCGCTCCCGGGAG
HKR420517 RBdS051E21 pGCAP10 NM_006007.2  
GGTTAGTCGGCCGGGACGCGGAGCTGTGTGCATCTCCTACGCGGGCTCGCTCGCTCCCGG
HKR441713 RBdS104E17 pGCAP10 NM_006007.2  
GANNNNTNANGGGACGCGGAGCTGTGTGCATCTCCTACGCGGGCTCGCTCGCTCCCGGGA
HKR470959 RBdS177G15 pGCAP10 NM_006007.2  
GGTTAGTCGGCCGGGNCNCGGAGCTGTGTGCATCTCCTACGCGGGCTCGCTCGCTCCCGG
HKR474835 RBdS187B11 pGCAP10 NM_006007.2  
GGTTAGTCGGCCGGGACGCGGAGCTGTGTGCATCTCCTACGCGGGCTCGCTCGCTCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl