Prev. |  KEGG KO K09229 > 

RIKEN DNA Bank Human Resource - ZNF213

Gene ID NCBI Gene 7760 |  KEGG hsa:7760
Gene Symbol ZNF213
Protein Name zinc finger protein 213
Synonyms CR53|ZKSCAN21|ZSCAN53
Ortholog resource in our bank

  ZNF213

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089071 IRAL022L07 pOTB7 BC007598 NM_004220 Partial/var
HGY089094 IRAL022M06 pOTB7 BC007287 NM_004220
HGY089880 IRAL024L16 pOTB7 BC012772 NM_004220 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE046080 W01A115D08 pENTR-TOPO IRAL022M06 BC007287 NM_004220  
HGE046084 W01A115D12 pENTR-TOPO IRAL022M06 BC007287 NM_004220  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205515 ARiS013N03 pGCAP10 NM_004220.2  
CGGCCGGCCGATGGCCGGGAGCTCGCGGCGGAAGTGGGATCTCCTGGGCCGTAGTGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl