DNA Bank Top |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF200

Gene ID NCBI Gene 7752 |  KEGG hsa:7752
Gene Symbol ZNF200
Protein Name zinc finger protein 200
Synonyms -

Link

Ortholog resource in our bank

  ZNF200


External database

human ZNF200

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB03792 SEREX clone NGO-St-015 (ID 37, 38) #1 SEREX clone NGO-St-015 (ID 37, 38) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011249 IRAK028C01 pCMV-SPORT6 BC012909 NM_198088 Full
HGX027700 IRAK069E04 pCMV-SPORT6 BC032575 NM_198088 Full
HGX046330 IRAK115N18 pCMV-SPORT6 BC054005 NM_198088 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052458 ARe31C10 pKA1U5 NM_003454.2  
GACTTCCCAGAAGGCACCGAGTCCCTGCCGTTCTCCTCAACTGGCGGCGGCGCGAACGAA
HKR056505 ARe41E09 pKA1U5 NM_003454.2  
GTCTCCCGGAGCCTGAGTCTCTGAGCCGTCCCCAGCAAACGCTCAGGGGCTGCAGAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl