Prev. | 

RIKEN DNA Bank Human Resource - ZNF185

Gene ID NCBI Gene 7739 |  KEGG hsa:7739
Gene Symbol ZNF185
Protein Name zinc finger protein 185 with LIM domain
Synonyms SCELL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184153 ARi60G09 pGCAP10 NM_007150.2  
GAGTCCGCGCCTCCTCGCCTCCCTGCGCGCTCCCCGCTGTGCACCGCGCCCCGCGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl