Prev. | 

RIKEN DNA Bank Human Resource - ZNF22

Gene ID NCBI Gene 7570 |  KEGG hsa:7570
Gene Symbol ZNF22
Protein Name zinc finger protein 22
Synonyms HKR-T1|KOX15|ZNF422|Zfp422
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005208 IRAK013A08 pCMV-SPORT6 BC010642 NM_006963 Full
HGY018744 IRAK046O08 pBluescriptR BC026193 NM_006963 Full
HGX033019 IRAK082J03 pCMV-SPORT6 BC041139 NM_006963
HGX046074 IRAK115D02 pCMV-SPORT6 BC053687 NM_006963 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR186153 ARi65G09 pGCAP10 NM_006963.4  
GGGAGGCGCCCAGCGAGCCAGAGTGNGGCTGGTCCGCGCGAAATTCTGAGCTGTACACCT
HKR444075 RBdS110D03 pGCAP10 NM_006963.4  
GGGCGCGGGAGGCGCCCAGCGAGCCAGAGTGGTGGCTGGTCCCGCGCGAAAATTCTGAGC
HKR444076 RBdS110D04 pGCAP10 NM_006963.4  
CCCAGGAGATCCCGCCCCTGCCACGCATCCCAGTGCATCCCTGCTTGGGGTGCCAGTAGC
HKR444253 RBdS110K13 pGCAP10 NM_006963.4  
GAGAGTGGTGGCTGGTCCCGCGCGAAAATTCTGAGCTGTACACCTCTAGGAAATGAAACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl