Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF7

Gene ID NCBI Gene 7553 |  KEGG hsa:7553
Gene Symbol ZNF7
Protein Name zinc finger protein 7
Synonyms HF.16|KOX4|zf30
Ortholog resource in our bank

  ZNF7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003106 W01A007M18 pENTR-TOPO IRAK119B10 BC058923 NM_003416  
HGE003110 W01A007M22 pENTR-TOPO IRAK119B10 BC058923 NM_003416  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420441 RBdS051B17 pGCAP10 NM_003416.2  
GCCGTTTCCGGCGGCGTCGCGCGTTTGCGAGCCTCGGGTGGTCCTCAGGGAGGCAGGATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl