Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF3

Gene ID NCBI Gene 7551 |  KEGG hsa:7551
Gene Symbol ZNF3
Protein Name zinc finger protein 3
Synonyms A8-51|HF.12|KOX25|PP838|Zfp113
Ortholog resource in our bank

  ZNF3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008654 IRAK021K14 pCMV-SPORT6 BC013603 NM_032924 Full
HGY091310 IRAL028E14 pOTB7 BC011887 NM_032924 Full
HGY096919 IRAL042E23 pOTB7 BC025265 NM_032924 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018891 W01A047D19 pENTR-TOPO IRAL042E23 BC025265 NM_032924  
HGE018895 W01A047D23 pENTR-TOPO IRAL042E23 BC025265 NM_032924  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR461963 RBdS154P03 pGCAP10 NM_017715.2  
GGTTCTGTCCCCGGTGTGTGGGTCTGTGACAGGGTCCAACAGGGCCTGGTCCGTGTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl