Prev. | Human A to Z list > Z > 

RIKEN DNA Bank Human Resource - ZIC2

Gene ID (NCBI) 7546
Gene Symbol ZIC2
Protein Name Zic family member 2
Synonyms HPE5
Databases KEGG hsa:7546 |  NCBI Gene 7546
Featured content Hedgehog signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06235)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385322 RBd63F02 pGCAP10 NM_007129.2  
GAGATCCAGGCGGCGGCGGAGGCGGCGGGCGCAGGAGAGCGGCTCCCAGGGCTGAAGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl