Prev. |  KEGG KO K06235 > 

RIKEN DNA Bank Human Resource - ZIC2

Gene ID NCBI Gene 7546 |  KEGG hsa:7546
Gene Symbol ZIC2
Protein Name Zic family member 2
Synonyms HPE5
Ortholog resources KEGG ortholog (KEGG orthology K06235) in the DNA Bank
Featured content Hedgehog signaling (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385322 RBd63F02 pGCAP10 NM_007129.2  
GAGATCCAGGCGGCGGCGGAGGCGGCGGGCGCAGGAGAGCGGCTCCCAGGGCTGAAGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl