Prev. | Human A to Z list > Y > 

RIKEN DNA Bank Human Resource - YWHAG

Gene ID (NCBI) 7532
Gene Symbol YWHAG
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma
Synonyms 14-3-3GAMMA
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Rb pathway
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K16198)


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045728 ARe14F08 pKA1U5 NM_012479.3  
GAGCCGCCTCGCGCCCGGTCCCGCGGTCGCAGCTCCNGCCGCCTCCTCCGCGCAGCCGCC
HKR057201 ARe43A01 pKA1U5 NM_012479.3  
TGAGCCGCCTCGCGCCCGGTCCCGCGGATCGCAGCATCCAGCCGCCTCCTCCGCGCAGCC
HKR360573 RBd01H05 pGCAP10 NM_012479.3  
GGCGGTCGCAGCTCCAGCCGCCTCCTCCGCGCAGCCGCCGCCTCAGCTGCTCGCTCTGTG
HKR367769 RBd19H01 pGCAP10 NM_012479.3  
GCCTTTCCCCTCGGGCCCGGCCCCCCGGTCGCCCCTCCAGGCTGCTCCTCCGCGCATCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl