Prev. | Human A to Z list > Y > 

RIKEN DNA Bank Human Resource - YWHAE

Gene ID (NCBI) 7531
Gene Symbol YWHAE
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon
Synonyms 14-3-3E|HEL2|KCIP-1|MDCR|MDS
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Rb pathway
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06630)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001359 IRAK003G15 pCMV-SPORT6 BC000179 NM_006761 Full
HGY081685 IRAL004D13 pOTB7 BC001440 NM_006761 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021289 W01A053D17 pENTR-TOPO flj0049l14 AK128785 NM_006761  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041231 ARe03B07 pKA1U5 NM_006761.4  
GATTGAGGCGCCGCCATTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAG
HKR081679 ARf04D07 pKA1U5 NM_006761.4  
GGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCAGACCCTGCCGGAGCCG
HKR081724 ARf04F04 pKA1U5 NM_006761.4  
GGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCAGACCCT
HKR048410 ARe21A10 pKA1U5 NM_006761.4  
AGGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCAGAC
HKR056056 ARe40C08 pKA1U5 NM_006761.4  
GGCCATTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGC
HKR181346 ARi53G02 pGCAP10 NM_006761.4  
GTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTC
HKR182025 ARi55B01 pGCAP10 NM_006761.4  
ATTTTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTT
HKR069660 ARe74C12 pKA1U5 NM_006761.4  
GGGATTGAGGCGCCGCCATTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGG
HKR070459 ARe76C11 pKA1U5 NM_006761.4  
GGAGCGAGAGGCTGAGAGAGTCGGAGACACTNCCCNTNTTCCATCCGTCGCGCAGACCCT
HKR208175 ARiS020H07 pGCAP10 NM_006761.4  
GGCTGCCCGGACGCNNAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCG
HKR260228 ARiS150J12 pGCAP10 NM_006761.4  
GGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCG
HKR277797 ARiS194I05 pGCAP10 NM_006761.4  
GGAGGCGCCGCCATTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACA
HKR364580 RBd11H12 pGCAP10 NM_006761.4  
GGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCG
HKR377722 RBd44F02 pGCAP10 NM_006761.4  
GGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCA
HKR416005 RBdS040A05 pGCAP10 NM_006761.4  
GGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCAGACCCT
HKR428093 RBdS070D21 pGCAP10 NM_006761.4  
GGAGGCGCCGCCATTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACA
HKR444366 RBdS110P06 pGCAP10 NM_006761.4  
GGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCG
HKR474935 RBdS187F15 pGCAP10 NM_006761.4  
GGGATTGAGGCGCCGCCATTTTTGCTGCCCGGACGCGGAGCGAGAGGCTGAGAGAGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl