Prev. | Human A to Z list > Y > 

RIKEN DNA Bank Human Resource - YWHAB

Gene ID (NCBI) 7529
Gene Symbol YWHAB
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta
Synonyms GW128|HEL-S-1|HS1|KCIP-1|YWHAA
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Rb pathway
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K16197)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081613 IRAL004A13 pOTB7 BC001359 NM_139323 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052850 ARe32C02 pKA1U5 NM_003404.3  
GGCGATCGGAGCGGAAGTGGAGCTACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTA
HKR186411 ARi66A11 pGCAP10 NM_003404.3  
GGGAAGTGGAGCTACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTAGTCGCCGCCGC
HKR072874 ARe82D02 pKA1U5 NM_003404.3  
GACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTAGTCGCCGCCGCCGCCGCCGCTGC
HKR218034 ARiS045B10 pGCAP10 NM_003404.3  
AAGTGGAGCTACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTAGTCGCCGCCGCCGC
HKR222336 ARiS055N24 pGCAP10 NM_003404.3  
GACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTAGTCGCCGCCGCCGCCGCCGCTGC
HKR361731 RBd04F11 pGCAP10 NM_003404.3  
GGCGATCGGAGCGGAAGTGGAGCTACCGCCACCGCCGCCGCCGATTGCGGAGCCGGGGTA
HKR332481 RBb31D09 pGCAP1 NM_003404.3  
HKR337204 RBb43A04 pGCAP1 NM_003404.3  
GTGGCGGAAGTGGAGCTACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTAGTCGCCG
HKR386053 RBd65C05 pGCAP10 NM_003404.3  
GGAAGTGGAGCTACCGCCACCGCCGCCGCCGATTGCGGAGCCGGGGTAGTCGCCGCCGCC
HKR432591 RBdS081H23 pGCAP10 NM_003404.3  
GGGCGATCGGAGCGGAAGTGGAGCTACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl