Prev. |  KEGG KO K09201 > 

RIKEN DNA Bank Human Resource - YY1

Gene ID NCBI Gene 7528 |  KEGG hsa:7528
Gene Symbol YY1
Protein Name YY1 transcription factor
Synonyms DELTA|GADEVS|INO80S|NF-E1|UCRBP|YIN-YANG-1
Ortholog resources KEGG ortholog (KEGG orthology K09201) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY029301 IRAK073E05 pBluescriptR BC037308 NM_003403 Full
HGY100232 IRAL050J16 pOTB7 BC065366 NM_003403 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE029526 W01A073N14 pENTR-TOPO IRAK073E05 BC037308 NM_003403  
HGE029534 W01A073N22 pENTR-TOPO IRAK073E05 BC037308 NM_003403  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186401 ARi66A01 pGCAP10 NM_003403.3  
GCTCCCTCTGCCTTCCTTCCCCACGGCCGGCCGCCTCCTCGCCCGCCCGCCCGCAGCCGA
HKR243617 ARiS109A17 pGCAP10 NM_003403.3  
GTTCCCCACGGCCGGCCGCCTCCTCGCCCGCCCGCCCGCAGCCGAGGAGCCGAGGCCGCC
HKR371347 RBd28G03 pGCAP10 NM_003403.3  
GGAGCAGAGTGTGGCGGCGGCGGCGAGATCTGGGCTCGGGTTGAGGAGTTGGTATTTGTG
HKR405980 RBdS014P20 pGCAP10 NM_003403.3  
GGCCTTCCTCCCTCTGCCTTCCTTCCCCACGGCCGGCCGCCTCCTCGCCCGCCCGCCCGC
HKR471064 RBdS177K24 pGCAP10 NM_003403.3  
GGAGTTGGTATTTGNNTNNAANGANGNGNAGGCNCAGNNNNANNGGCGNTNNNANGCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl