Prev. | Human A to Z list > X > 

RIKEN DNA Bank Human Resource - XRCC1

Gene ID (NCBI) 7515
Gene Symbol XRCC1
Protein Name X-ray repair complementing defective repair in Chinese hamster cells 1
Synonyms RCC
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10803)


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008043 W01A020B19 pENTR-TOPO IRAL033F09 BC023593 NM_006297  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR368011 RBd20A11 pGCAP10 NM_006297.2  
GCTTCTGGCCAGGCGAAGCCCACGACGTTGACATGCCGGAGATCCGCCTCCGCCATGTCG
HKR398811 RBd97A11 pGCAP10 NM_006297.2  
GCGCTCTCCCTGCCCCTCGGACCCCATACTCTACCTCATCCTTCTGGCCAGGCGAAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl