Prev. |  KEGG KO K10803 > 

RIKEN DNA Bank Human Resource - XRCC1

Gene ID NCBI Gene 7515 |  KEGG hsa:7515
Gene Symbol XRCC1
Protein Name X-ray repair cross complementing 1
Synonyms RCC|SCAR26
Featured content DNA repair (human)
Ortholog resource in our bank

  XRCC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008043 W01A020B19 pENTR-TOPO IRAL033F09 BC023593 NM_006297  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368011 RBd20A11 pGCAP10 NM_006297.2  
GCTTCTGGCCAGGCGAAGCCCACGACGTTGACATGCCGGAGATCCGCCTCCGCCATGTCG
HKR398811 RBd97A11 pGCAP10 NM_006297.2  
GCGCTCTCCCTGCCCCTCGGACCCCATACTCTACCTCATCCTTCTGGCCAGGCGAAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl