Prev. |  KEGG KO K01262 > 

RIKEN DNA Bank Human Resource - XPNPEP1

Gene ID NCBI Gene 7511 |  KEGG hsa:7511
Gene Symbol XPNPEP1
Protein Name X-prolyl aminopeptidase 1
Synonyms APP1|SAMP|XPNPEP|XPNPEPL|XPNPEPL1
Ortholog resource in our bank

  XPNPEP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084530 IRAL011F10 pOTB7 BC013417 NM_020383 Partial/var
HGY085791 IRAL014H23 pOTB7 BC005126 NM_020383 Full
HGY088986 IRAL022H18 pOTB7 BC007579 NM_020383

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR320880 RBb02D08 pKA1U5 NM_020383.2  
GGACCCGGCGCTAGCCCGCCCGCCCGCCGGCTCTCGCGCCTCCTTCGCGCCGGCCCTTCC
HKR327201 RBb18A01 pKA1U5 NM_020383.2  
GACCGCCGAATGGCAGCCTCCAGAAAGCCACCGCGAGTAAGGGTGAATCACCAGGATTTT
HKR348835 RBb72B11 pGCAP1 NM_020383.2  
TGTGCTCCTTCGCGCCGGCCCTTCCGCGGGTGATCAGCTGGTCTGCGCTCCCCTGACGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl