Prev. | Human A to Z list > X > 

RIKEN DNA Bank Human Resource - XPA

Gene ID (NCBI) 7507
Gene Symbol XPA
Protein Name xeroderma pigmentosum, complementation group A
Synonyms XP1|XPAC
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY093928 IRAL034N16 pOTB7 BC014965 NM_000380

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE018303 W01A045M15 pENTR-TOPO IRAL034N16 BC014965 NM_000380
HGE018305 W01A045M17 pENTR-TOPO IRAL034N16 BC014965 NM_000380
HGE018311 W01A045M23 pENTR-TOPO IRAL034N16 BC014965 NM_000380
HGE018359 W01A045O23 pENTR-TOPO IRAL034N16 BC014965 NM_000380

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR080554 ARf01G10 pKA1U5 NM_000380.3
GGGAGTGGGCCGGAGATGGCGGCGGCCGACGGGGCTTTGCCGGAGGCGGCGGCTTTAGAG
HKR219852 ARiS049K12 pGCAP10 NM_000380.3
GAGTGCGCGTGCGTGGAGCTGGGAGCTAGGTCCTCGGAGTGGGCCGGAGATGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl