Prev. | 

RIKEN DNA Bank Human Resource - XPA

Gene ID NCBI Gene 7507 |  KEGG hsa:7507
Gene Symbol XPA
Protein Name XPA, DNA damage recognition and repair factor
Synonyms XP1|XPAC
Featured content DNA repair (human)
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093928 IRAL034N16 pOTB7 BC014965 NM_000380.4 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018303 W01A045M15 pENTR-TOPO IRAL034N16 BC014965 NM_000380  
HGE018305 W01A045M17 pENTR-TOPO IRAL034N16 BC014965 NM_000380  
HGE018311 W01A045M23 pENTR-TOPO IRAL034N16 BC014965 NM_000380  
HGE018359 W01A045O23 pENTR-TOPO IRAL034N16 BC014965 NM_000380  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080554 ARf01G10 pKA1U5 NM_000380.3  
GGGAGTGGGCCGGAGATGGCGGCGGCCGACGGGGCTTTGCCGGAGGCGGCGGCTTTAGAG
HKR219852 ARiS049K12 pGCAP10 NM_000380.3  
GAGTGCGCGTGCGTGGAGCTGGGAGCTAGGTCCTCGGAGTGGGCCGGAGATGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl