Prev. |  KEGG KO K00182 > 

RIKEN DNA Bank Human Resource - WNT2B

Gene ID NCBI Gene 7482 |  KEGG hsa:7482
Gene Symbol WNT2B
Protein Name Wnt family member 2B
Synonyms WNT13
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Hedgehog signaling (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  WNT2B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243611 ARiS109A11 pGCAP10 NM_004185.3  
GACTCTCTCNGCAGGACCCCCACCCTGGCCTCTGGTGCGGGAAAACCTCCCAGCTGTTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl