Prev. |  KEGG KO K01867 > 

RIKEN DNA Bank Human Resource - WARS1

Gene ID NCBI Gene 7453 |  KEGG hsa:7453
Gene Symbol WARS1
Protein Name tryptophanyl-tRNA synthetase 1
Synonyms GAMMA-2|HMN9|IFI53|IFP53|WARS
Ortholog resource in our bank

  WARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089475 IRAL023L11 pOTB7 BC017489 NM_213646 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167281 ARi18D09 pGCAP10 NM_004184.3  
GGGGTGATTTATAAGAAACCCTTAGCTGAATGCAGGGTGGGGAGAACGAAAGACAAAAGC
HKR248917 ARiS122E21 pGCAP10 NM_004184.3  
GACCAGCTAATGGCTCGATTCTCAAGAGGGTTTCATTGGTCTCAACCTGGCCCCCCAGGC
HKR408995 RBdS022I03 pGCAP10 NM_004184.3  
GACAGCCGGTTGCTGAGCCGGGAGCGCTGACTGGCCCGGCTGGGCAGGTCTTGACTCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl