Prev. |  KEGG KO K01873 > 

RIKEN DNA Bank Human Resource - VARS1

Gene ID NCBI Gene 7407 |  KEGG hsa:7407
Gene Symbol VARS1
Protein Name valyl-tRNA synthetase 1
Synonyms G7A|NDMSCA|VARS|VARS2
Ortholog resource in our bank

  VARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13276 pUC-T7-EMCV-GST-ValRS EMCV IRES-dependent expression vector of human valyl-tRNA synthetase

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084415 IRAL011A15 pOTB7 BC012808 NM_006295 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098014 M01C045A14 pDONR221 MGC12-B07 BC012808 NM_006295  
HGE098062 M01C045C14 pDONR221 MGC12-B07 BC012808 NM_006295  
HGE098110 M01C045E14 pDONR221 MGC12-B07 BC012808 NM_006295  
HGE098158 M01C045G14 pDONR221 MGC12-B07 BC012808 NM_006295  
HGE098206 M01C045I14 pDONR221 MGC12-B07 BC012808 NM_006295  
HGE098254 M01C045K14 pDONR221 MGC12-B07 BC012808 NM_006295  
HGE098302 M01C045M14 pDONR221 MGC12-B07 BC012808 NM_006295  
HGE098350 M01C045O14 pDONR221 MGC12-B07 BC012808 NM_006295  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054556 ARe36G12 pKA1U5 NM_006295.2  
GGCCGGGGCGGCGATCTTAGGGAACTAGGGTCACCTGGAGAGCCGCCCACCGTCTCTGCC
HKR174429 ARi36B05 pGCAP10 NM_006295.2  
GGCCGGGGCGGCGATCTTAGGGAACTAGGGTCACCTGGAGAGCCGCCCACCGTCTCTGCC
HKR176875 ARi42D03 pGCAP10 NM_006295.2  
TGGACACGTGGGCGCCGGCTGCCGGGGCGGCGATCTTAGGGAACTAGGGTCACCTGGAGA
HKR235039 ARiS087J23 pGCAP10 NM_006295.2  
HKR238422 ARiS096A22 pGCAP10 NM_006295.2  
ACAAAGGGGGGAACACGTGGGCGCCGGCTGCCGGGGCGGCGATCTTAGGGAACTAGGGTC
HKR247453 ARiS118K13 pGCAP10 NM_006295.2  
GACACGNNGNCGCCGGCTGCCGGGGCGGCGATCTTAGGGAACTAGGGTCACCTGGAGAGC
HKR405508 RBdS013M20 pGCAP10 NM_006295.2  
GNCNCGTGGGCGCCGGCTGCCGGGGCGGCGATCTTAGGGAACTAGGGTCACCTGGAGAGC
HKR444216 RBdS110I24 pGCAP10 NM_006295.2  
GGGAAACGCTCCCTGTCACAAAGGGGGGAACACGTGGGCGCCGGCTGCCGGGGCGGCGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl