Prev. |  KEGG KO K01599 > 

RIKEN DNA Bank Human Resource - UROD

Gene ID NCBI Gene 7389 |  KEGG hsa:7389
Gene Symbol UROD
Protein Name uroporphyrinogen decarboxylase
Synonyms PCT|UPD
Ortholog resources KEGG ortholog (KEGG orthology K01599) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083256 IRAL008C08 pOTB7 BC001778 NM_000374 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168484 ARi21D12 pGCAP10 NM_000374.3  
GAGCTGACCATGGAAGCGAATGGGTTGGGACCTCAGGGTTTTCCGGAGCTGAAGAATGAC
HKR184169 ARi60H01 pGCAP10 NM_000374.3  
GGCAGTTACAGACAGCTGACCATGGAAGCGAATGGGTTGGGCCTCCAGCGTAGCATACTG
HKR222051 ARiS055C03 pGCAP10 NM_000374.3  
GAGGCTCAGATTCAGGTTAAATTGTGGATTGAGCTCGCAGTTACAGACAGCTGACCATGG
HKR320973 RBb02H05 pKA1U5 NM_000374.3  
GAGTTACAGACAGCTGACCATGGAAGCGAATGGGTTGGGACCTCAGGGTTTTCCGGAGCT
HKR320974 RBb02H06 pKA1U5 NM_000374.3  
GAGTTACAGACAGCTGACCATGGAAGCGAATGGGTTGGGACCTCAGGGTTTTCCGGAGCT
HKR341657 RBb54C09 pGCAP1 NM_000374.3  
TGCTGGAGCTGTCGCTGGAGTCCGATCATGTGATCTTCAACATGGCGACGCTCTTGGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl