Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NR1H2

Gene ID (NCBI) 7376
Gene Symbol NR1H2
Protein Name nuclear receptor subfamily 1 group H member 2
Synonyms LXR-b|LXRB|NER|NER-I|RIP15|UNR
Databases KEGG hsa:7376 |  NCBI Gene 7376
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08535)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06066 pCMFlag_hsNR1H2 Expression vector of human LXR beta

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX039553 IRAK098O17 pCMV-SPORT6 BC047750 NM_007121 Full
HGY088019 IRAL020A19 pOTB7 BC007790 NM_007121 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002243 W01A005K03 pENTR-TOPO IRAL020A19 BC007790 NM_007121  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076576 ARe91H08 pKA1U5 NM_007121.4  
GGAAGTTACTTTTGAGGGTATTTGAGTAGCGGCGGTGTGTCAGGGGCTAAAGAGGAGGAC
HKR461751 RBdS154G07 pGCAP10 NM_007121.4  
GGAAGTTACTTTTGAGGGTATTTGAGTAGCGGCGGTGTGTCAGGGGCTAAAGAGGAGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.08.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl