Prev. |  KEGG KO K15272 > 

RIKEN DNA Bank Human Resource - SLC35A2

Gene ID NCBI Gene 7355 |  KEGG hsa:7355
Gene Symbol SLC35A2
Protein Name solute carrier family 35 member A2
Synonyms CDG2M|CDGX|UDP-Gal-Tr|UGALT|UGAT|UGT|UGT1|UGT2|UGTL
Ortholog resource in our bank

  SLC35A2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031894 IRAK079M06 pCMV-SPORT6 BC035747 NM_005660

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR369601 RBd24A01 pGCAP10 NM_005660.1  
GGGGACGGGCCGGGCAGATGCCAACATGGCAGCGGTTGGGGCTGGTGGTTCCACCGCGGC
HKR385234 RBd63B10 pGCAP10 NM_005660.1  
GAGATGCCAACATGGCAGCGGTTGGGGCTGGTGGTTCCACCGCGGCGCCCGGGCCAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl