Prev. |  KEGG KO K15103 > 

RIKEN DNA Bank Human Resource - UCP2

Gene ID NCBI Gene 7351 |  KEGG hsa:7351
Gene Symbol UCP2
Protein Name uncoupling protein 2
Synonyms BMIQ4|SLC25A8|UCPH
Ortholog resource in our bank

  UCP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014134 W01A035F14 pENTR-TOPO IRAL027P19 BC011737 NM_003355 done
HGE014136 W01A035F16 pENTR-TOPO IRAL027P19 BC011737 NM_003355  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063257 ARe58C09 pKA1U5 NM_003355.2  
GCCCACTGCGAAGCCCAGCTGCGCGCGCCTTGNGATTGACTGTCCACGCTCGCCCGGCTC
HKR166057 ARi15C09 pGCAP10 NM_003355.2  
GACTGCGAAGCCCAGCTGCGCGCGCCTTGGGATTGACTGTCCACGCTCGCCCGGCTCGTC
HKR178546 ARi46G02 pGCAP10 NM_003355.2  
GACTGCGAAGCCCAGCTGCGCGCGCCTTGGGATTGACTGTCCACGCTCGCCCGGCTCGTC
HKR234883 ARiS087D11 pGCAP10 NM_003355.2  
GACTGCGAAGCCCAGCTGCGCGCGCCTTGGGATTGACTGTCCACGCTCGCCCGGCTCGTC
HKR279354 ARiS198G10 pGCAP10 NM_003355.2  
GACTGCGAAGCCCAGCTGCGCGCGCCTTGGGATTGACTGTCCACGCTCGCCCGGCTCGTC
HKR384128 RBd60F08 pGCAP10 NM_003355.2  
GACAGCCGCACGCACTGCCGTGTTCTCCCTGCGGCTCGGACACATAGTATGACCATTAGG
HKR395730 RBd89F10 pGCAP10 NM_003355.2  
GACTGCGAAGCCCAGCTGCGCGCGCCTTGGGATTGACTGTCCACGCTCGCCCGGCTCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl