Prev. |  KEGG KO K05609 > 

RIKEN DNA Bank Human Resource - UCHL3

Gene ID NCBI Gene 7347 |  KEGG hsa:7347
Gene Symbol UCHL3
Protein Name ubiquitin C-terminal hydrolase L3
Synonyms UCH-L3
Ortholog resource in our bank

  UCHL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008889 IRAK022D17 pCMV-SPORT6 BC018125 NM_006002

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081378 ARf03H10 pKA1U5 NM_006002.3  
GGTCAGAGCTGGAGGGCCGGGCACCGCGGCCATGGAGGGTCAACGCTGGCTGCCGCTGGA
HKR209327 ARiS023F07 pGCAP10 NM_006002.3  
GAGGGTCAAGGCGCGCGTGGGCGGAAGCGGCGGCGGCTGTCAGAGCTGGAGGGCCGGGCA
HKR243976 ARiS109P16 pGCAP10 NM_006002.3  
AGAGCTGGAGGGCCGGGCACCGCGGCCATGGAGGGTCAACGCTGGCTGCCGCTGGAGGCC
HKR395769 RBd89H01 pGCAP10 NM_006002.3  
GAGGCGGCGGCTGTCAGAGCTGGAGGGCCGGGCACCGCGGCCATGGAGGGTCAACGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl