Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SUMO1

Gene ID (NCBI) 7341
Gene Symbol SUMO1
Protein Name small ubiquitin-like modifier 1
Synonyms DAP1|GMP1|OFC10|PIC1|SENP2|SMT3|SMT3C|SMT3H3|UBL1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA damage


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX046001 IRAK115A01 pCMV-SPORT6 BC053528 NM_003352 Full
HGY066900 IRAK167E04 pBluescriptR BC066306 NM_003352 Full/var
HGY083332 IRAL008F12 pOTB7 BC006462 NM_003352 Full
HGY088647 IRAL021K07 pDNR-LIB BC005899 NM_003352 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE097602 M01C044A02 pDONR221 MGC11-F01 BC006462 NM_003352
HGE097650 M01C044C02 pDONR221 MGC11-F01 BC006462 NM_003352
HGE097698 M01C044E02 pDONR221 MGC11-F01 BC006462 NM_003352
HGE097746 M01C044G02 pDONR221 MGC11-F01 BC006462 NM_003352
HGE097794 M01C044I02 pDONR221 MGC11-F01 BC006462 NM_003352
HGE097842 M01C044K02 pDONR221 MGC11-F01 BC006462 NM_003352
HGE097890 M01C044M02 pDONR221 MGC11-F01 BC006462 NM_003352
HGE097938 M01C044O02 pDONR221 MGC11-F01 BC006462 NM_003352

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR053349 ARe33G05 pKA1U5 NM_003352.4
GGTAAACCCCGGAGCGAGGTTCTGCTTACCCGACGCCGCTGCTGTGCGGAGACCCCCGGG
HKR247582 ARiS118P22 pGCAP10 NM_003352.4
HKR279521 ARiS198N09 pGCAP10 NM_003352.4
CACTCAGGTTTCTCTTTGAGGGNCAAAAAATTGNTGATTNTCNNNCTCCNAANCACCTNN
HKR324577 RBb11H09 pKA1U5 NM_003352.4
TAGAAGGATTTGTAAACCCCGGAGCGAGGTTCTGCTTACCCGAGGCCGCTGCTGTGCGGA
HKR334149 RBb35G05 pGCAP1 NM_003352.4
TGTGGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTCTGCTTA
HKR341276 RBb53D04 pGCAP1 NM_003352.4
GAGCCGCGGTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTC
HKR343374 RBb58H06 pGCAP1 NM_003352.4
GGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTCTGCTTACCCGAGGCCGCTG
HKR380508 RBd51E12 pGCAP10 NM_003352.4
GAGCCGCGGTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTC
HKR399756 RBd99G12 pGCAP10 NM_003352.4
GAGCCGCGGTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTC
HKR402880 RBdS007D08 pGCAP10 NM_003352.4
GAGCCGCGGTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAAACCCCGGAGCGAGGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl