Prev. |  KEGG KO K06689 > 

RIKEN DNA Bank Human Resource - UBE2D3

Gene ID NCBI Gene 7323 |  KEGG hsa:7323
Gene Symbol UBE2D3
Protein Name ubiquitin conjugating enzyme E2 D3
Synonyms E2(17)KB3|UBC4/5|UBCH5C
Ortholog resources KEGG ortholog (KEGG orthology K06689) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001364 IRAK003G20 pCMV-SPORT6 BC003395 NM_181891 Full
HGY030177 IRAK075H09 pBluescriptR BC037894 NM_181891 Full
HGY066833 IRAK167B09 pBluescriptR BC066917 NM_181891 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041731 ARe04F11 pKA1U5 NM_003340.4  
ATCTTGNTGGCCTGNTGNTCGTGCGCGATGTAGCCCCGTTAGGGCCGGGGAGGCACCAGC
HKR053773 ARe34H05 pKA1U5 NM_003340.4  
GGTGCTCGTGCGCGTGAGCCCCGTAGGGCCGGGNCAGGCACCAGCTGCCGCGCGGGGAGG
HKR074057 ARe85C09 pKA1U5 NM_003340.4  
GGTAGGGCCGGGGAGGCACCAGCTGCCGCGCGGGGAGGAGGCCGAGGCCGCAGCTTGAGG
HKR077775 ARe94H07 pKA1U5 NM_003340.4  
GGTTAGCCAGCCACGAAGTTCTCGCGAGAGTCGTCTCCTCGATACCAAGCGCCTGTGTCT
HKR181730 ARi54F10 pGCAP10 NM_003340.4  
GCGTGGGTGTGGACGGCTAGGGCAGGGAAGGGAGGCCN
HKR186883 ARi67D11 pGCAP10 NM_003340.4  
GCCCCGTAGGGCCGGGGAGGCACCAGCTGCCGCGCGGGGAGGAGGCCGAGGCCGCAGCTT
HKR186904 ARi67E08 pGCAP10 NM_003340.4  
GGGCTGTGTCGTGCGCGTGAGCCCCGTAGGGCCGGGGAGGCACCAGCTGCCGCGCGGGGA
HKR208054 ARiS020C06 pGCAP10 NM_003340.4  
TTGGACATCTTGTGGCTGTGTCGTGCGCGTGAGCCCCGTAGGGCCGGGGAGGCACCAGCT
HKR208141 ARiS020F21 pGCAP10 NM_003340.4  
TTGGACATCTTGTGGCTGTGTCGTGCGCGTGAGCCCCGTAGGGCCGGGGAGGCACCAGCT
HKR320955 RBb02G11 pKA1U5 NM_003340.4  
GACTCGTTCACCCTCCCCCCAGCTCATGATCCTCCTCCCATCCCCCGCCCTCCTGGATCC
HKR339212 RBb48A12 pGCAP1 NM_003340.4  
HKR384052 RBd60C04 pGCAP10 NM_003340.4  
GAGTTCCGTCAGAGCGGACATCTTGTGGCTGTGTCGTGCGCGTGAGCCCCGTAGGGCCGG
HKR386454 RBd66C06 pGCAP10 NM_003340.4  
GGTCTCCTTCCGGTTCTCGATGCTTCTCTGAGCCTAAGGGTTTCCGCCACTCGTTCACCC
HKR387628 RBd69B04 pGCAP10 NM_003340.4  
GAGAGCGGACATCTTGTGGCTGTGTCGTGCGCGTGAGCCCCGTAGGGCCGGGGAGGCACC
HKR402895 RBdS007D23 pGCAP10 NM_003340.4  
TGCTAGAGGCCGGGAAGTTAAACTTGTAGCCACCACCTCCGCTCTTCCCGTCACCCTCGC
HKR403168 RBdS007P08 pGCAP10 NM_003340.4  
GAGTAGTTCCGTCAGAGCGGACATCTTGTGGCTGTGTCGTGCGCGTGAGCCCCGTAGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl